SenseLab
Chemosensory Receptors
  Data
ORL9358
PREDICTED: Gallus gallus similar to olfactory receptor 125 (LOC431501), mRNA
atgagccagcagtttgccctcacagccaaaagagccaaccatcccctggggtgcatcagggccagcactgatggcctctgggtgtttagggaaagaggaccccactgtcaacatgtcaacctggcactttctgtcagcctctcagaggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcagattgtgctgcacaggtctttttctttgtcttcttcatctcggcagaatattcccttctcactgtgatgtcctatgaccgctatgttgccatctgcaagccccagcaatatgggaccctgctgggcatcagagcttgtgccaccatggcagcagctgcctggggctctgggcttctgtattccctactgcacactgccaatacattctccctgcctctgtgccaaggaaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctcctgctcagatgcctacctcagagaaatttggctacttgtggtcagtgcttctttagtatctggttgctttgctttcatttttttctcctatgtgcagattttcagggctgtgctgaggatgccctctgagcagggacggcacaaagccttctccacatgccttcctcacctggctgtggtctccctgtttgcttgcagtggtacttttgcctatgtgaagccccagtccctctcctccccacccctggatctgacagtaacagttctgtattcagtgtttcctccaacagtgaaccctcttatctacagtgttagaaataaggagctcatgtgttccattaggaaagtcatttcacaaatgtttatgaactgtgataagttcactctctgttcttgcagtctttag
MSQQFALTAKRANHPLGCIRASTDGLWVFRERGPHCQHVNLALSVSLSEAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYADCAAQVFFFVFFISAEYSLLTVMSYDRYVAICKPQQYGTLLGIRACATMAAAAWGSGLLYSLLHTANTFSLPLCQGNAVDQFFCEIPQILKLSCSDAYLREIWLLVVSASLVSGCFAFIFFSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVVSLFACSGTFAYVKPQSLSSPPLDLTVTVLYSVFPPTVNPLIYSVRNKELMCSIRKVISQMFMNCDKFTLCSCSL
Other categories referring to ORL9358
Revisions: 1
Last Time: 3/21/2008 11:06:59 AM
Reviewer: CC student
Owner: CC student