SenseLab
Chemosensory Receptors
  Data
ORL9360
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC431474), mRNA
atgtccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcaggatgtgctgcacaggtctttttctttctcttcttcctctcggcagagtattcccttctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgagcagcagagcttgtgccaccatggcagcagctgcctggggcactggggctctctatgctctgctgcacactgccaacacattttccctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctcttgtgctcaaaatcctatctcagggaaattgggcttattgtgcttagtgtccttgccatgtttgggtgttttgttttcattgttgtgtcctatgtgcagatcttcagggctgtgctgcggatgccctctgagcagggacggcacaaagccttctccatgtgtctccctcacctggccgtgctctccctgttggtcagcacgggcttttttgcctacctgaagcccccctctatctcctccccattcctggatctaacagtggcacttctgtactcagtggttcctccaacactgaaccccgttatctacagcatgaggaacaaggagctcaggcatactctcaacaaagtgttgcagtatgcactattccagcttcaataa
MSNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCAAQVFFFLFFLSAEYSLLTIMSYDRYVAICKPLHYGTLLSSRACATMAAAAWGTGALYALLHTANTFSLPLCQGNAVDQFFCEIPQILKLLCSKSYLREIGLIVLSVLAMFGCFVFIVVSYVQIFRAVLRMPSEQGRHKAFSMCLPHLAVLSLLVSTGFFAYLKPPSISSPFLDLTVALLYSVVPPTLNPVIYSMRNKELRHTLNKVLQYALFQLQ
Other categories referring to ORL9360
Revisions: 1
Last Time: 3/21/2008 11:11:13 AM
Reviewer: CC student
Owner: CC student