SenseLab
Chemosensory Receptors
  Data
ORL9363
PREDICTED: Gallus gallus similar to olfactory receptor 5 (LOC431422), mRNA
atgggcaattatggacctgccagtctcattccagtgcctgtgctagaagatgttttgagcaatttggctgatgataccaaattagaaggagttgtctccactgaaggtggagaggacttgcagagagatgtggacaagttagagaactgggcaagcaccaactgcatgaagtataacaagaacaagggcctgattctgcacctgggaaggcacaaccctgttcttgtgcccacaggtcctggtgcccagacgtatcagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaacagggccatctcctacgcaggatgtgctacacaggtctttttctttgtcttcttcatctcttcagattattcccttctcaccatgatgtcctatgactgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccatcatggcagcagctgcctggggcactgggcttttccatgctttgctgcacactgccaatacattctccctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctcctgctcagatgcctacctcagggaagctgggcttattgtggttagtgtccttttggagcttgggtgttttgtcttcattgttgtgtcctatgtgcagatcttcagggctgtgctgaggataccctctgagcaggggcggcacaaagccttctccacgtgcctccctcacctggccgtgctctcccttctcgtcagctctgccttttttgcctacctgaagccctcttccatttcctctccatccctggatctggtggtgtcatttctgtactcagtggtgcctccagcagtgaaccccctcatctacagcatgaggaaccaggagctcaaggatgctctgtggaaactgatgaccaaatatatttggaaagcaatgaactgcccttctttatctctacatgtcttgtaa
MGNYGPASLIPVPVLEDVLSNLADDTKLEGVVSTEGGEDLQRDVDKLENWASTNCMKYNKNKGLILHLGRHNPVLVPTGPGAQTYQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHNRAISYAGCATQVFFFVFFISSDYSLLTMMSYDCYVAICKPLHYGTLLGSRACAIMAAAAWGTGLFHALLHTANTFSLPLCQGNAVDQFFCEIPQILKLSCSDAYLREAGLIVVSVLLELGCFVFIVVSYVQIFRAVLRIPSEQGRHKAFSTCLPHLAVLSLLVSSAFFAYLKPSSISSPSLDLVVSFLYSVVPPAVNPLIYSMRNQELKDALWKLMTKYIWKAMNCPSLSLHVL
Other categories referring to ORL9363
Revisions: 1
Last Time: 3/21/2008 11:16:45 AM
Reviewer: CC student
Owner: CC student