SenseLab
Chemosensory Receptors
  Data
ORL9365
PREDICTED: Gallus gallus similar to olfactory receptor MOR219-1 (LOC431267), mRNA
atgaactttcctggactccgtgcccaggaaccgccgctgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcccttctggctcctgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgcacttcttcctcctcaacctcgccctcctcgacctgggccgcgtctccgccgctctccccaaagccacggccaacgccccctggcacaccggggccatctcctactcaggatgtattgcccaaacctttccgtacgtccttctgtttccaggagggtattcccttctcaccgtcacggcctatgaccgctacgttgccatctgcaatcccctgcgctacgggaccctgctgggcagcagagctttcaccaccctggcagcagctgcctggggcactgctgtgttgcaaactgcccatacgttttctctgcctctctgccaaggcaatgctgtggatcagttctcctgtgaaatcccccggatcctcgagctctcctgctcagaatcctatctcggggaagttgggcttcttgtccttattgtccttgtcttatttgggtgctttgctttcattctcttctcccacgcgcagatcttcagggccgtgctggggatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggccgtgctctccctgttagtcagcactgccctgtttgcctacctgaagcccccctccgtctcctccccatccatggacccgatggtggctgttctctactcggtggtgcccccagcagtgaacgccctcatttacagcatgcggaaccaggagctcaggaacaccctcagaaaatgttccaatacacactgtttctccatcgaaaagattttcatcactctctga
MNFPGLRAQEPPLPNSSSISEFLLLALADTRQLQLLPFWLLLGIYLAALLGNGLISTAVACDHRLHTPMHFFLLNLALLDLGRVSAALPKATANAPWHTGAISYSGCIAQTFPYVLLFPGGYSLLTVTAYDRYVAICNPLRYGTLLGSRAFTTLAAAAWGTAVLQTAHTFSLPLCQGNAVDQFSCEIPRILELSCSESYLGEVGLLVLIVLVLFGCFAFILFSHAQIFRAVLGMPSEQGRHKAFSTCLPHLAVLSLLVSTALFAYLKPPSVSSPSMDPMVAVLYSVVPPAVNALIYSMRNQELRNTLRKCSNTHCFSIEKIFITL
Other categories referring to ORL9365
Revisions: 1
Last Time: 3/21/2008 11:20:32 AM
Reviewer: CC student
Owner: CC student