SenseLab
Chemosensory Receptors
  Data
ORL9366
PREDICTED: Gallus gallus similar to olfactory receptor Olfr305 (LOC431203), mRNA
atgtgtgcagcagaactgctcaggatttctgaattcattgaacactccttgaccacggttcttgagcacacaggtcctggtgcccagaagtaccagatggccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcaggatgtgctgcacaggtcttctttttactattcttctttggagcagagtattcccttctcaccatcatgtcctatgatcgctacgttgccatctgcaagcccctgcactatgggaccctcctgagcagcagagcttgtgccaccatggcagcagctgcctggggcactgggcttctctattccctgctgcacactgccaatacattttctatagctttctgccttagtaatgctgttgatcaattcttctgtgaaatggcccagatcctcaagctttcttgctcagaatccgactacctcagggcaactaggattatttactttagcctttgtttaatctttggatgttttgtcttcattgttttgtcttatgtgcagatcttcagggccgtgctgaggatgccctctgagcagggacagcacaaaaccttctccacgtgcctccctcacctggccgtggtttccttgtttgtcagcactgtgatgttttcctacctgaaacccccctccatctcatctcgatccctggacctgctggtgtcatctgtgtattccttgttgcctccaacactgaatcccctcatctacagcatgaggaaccaggagcttaaggataccctgagaaaacttctagataaacactataaacaagccattggaaactcatttctttcagcagccatgtctctcctgctctggacctggtggagcaaagtcgttatgcagcccttcctggctggtgagtatgagacccagcagaacacctctcctttttggttcctctatggcatggtcaaaaagctgccatctgtgctctccagggatgtcctggacggtgtatgccctgctgtgctgtccctgcagcagacactagagtga
MCAAELLRISEFIEHSLTTVLEHTGPGAQKYQMANSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCAAQVFFLLFFFGAEYSLLTIMSYDRYVAICKPLHYGTLLSSRACATMAAAAWGTGLLYSLLHTANTFSIAFCLSNAVDQFFCEMAQILKLSCSESDYLRATRIIYFSLCLIFGCFVFIVLSYVQIFRAVLRMPSEQGQHKTFSTCLPHLAVVSLFVSTVMFSYLKPPSISSRSLDLLVSSVYSLLPPTLNPLIYSMRNQELKDTLRKLLDKHYKQAIGNSFLSAAMSLLLWTWWSKVVMQPFLAGEYETQQNTSPFWFLYGMVKKLPSVLSRDVLDGVCPAVLSLQQTLE
Other categories referring to ORL9366
Revisions: 1
Last Time: 3/21/2008 11:22:52 AM
Reviewer: CC student
Owner: CC student