SenseLab
Chemosensory Receptors
  Data
ORL9367
PREDICTED: Gallus gallus similar to olfactory receptor, family 5, subfamily U member 1 (LOC426576), mRNA
atgtccagggggagcagtgtggaagagaaaatcacatcctcagcacctgagctgggccaggctccagggacacagatagctcatacaagactccatgcccaggaaccgcagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccagggccatctcctacgcaggatgtgctgcacaggtctttttctttctcttcttcatctcagcagagtattgcattctcaccatcatgtcctatgaccgctacgttgccatctgcaaacccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcatggggcactgggcttctctattccctgctgcacactgccaatacattttcactgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctcgcctgctcagaatcagaatttctaagggaacttggactcctcagtactagtgcctttattggagttgggtgttttgtcttcattgttgtgtcctatgtgcagatcttcagggccgtgctgaggatgccttctgagcagggacggcacaaagccttctccacgtgcctccctcacctggctgtgctctccctctttgtcagcaccgtagtgtttgcctacctgaagccacccgctatttcctttcaatccctggacctggtggtgtcatttctgtacacagtggggcctccaacagtgaacccccttatctacagcatgaggaaccagaagctcaaggatgctctgtggaaactggtgaccagttgtattttgaaaacaatgaactgcccatctttatctgtacatgacttgtaa
MSRGSSVEEKITSSAPELGQAPGTQIAHTRLHAQEPQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRAISYAGCAAQVFFFLFFISAEYCILTIMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGLLYSLLHTANTFSLPLCQGNAVDQFFCEIPQILKLACSESEFLRELGLLSTSAFIGVGCFVFIVVSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVLSLFVSTVVFAYLKPPAISFQSLDLVVSFLYTVGPPTVNPLIYSMRNQKLKDALWKLVTSCILKTMNCPSLSVHDL
Other categories referring to ORL9367
Revisions: 1
Last Time: 3/21/2008 11:25:20 AM
Reviewer: CC student
Owner: CC student