SenseLab
Chemosensory Receptors
  Data
ORL9368
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC430986), mRNA
atgggcaattatggacctgacagtctcattctggtgcctggactccatgcccacgaactgcgaatgcccaacagcagctccatcagtgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccacctgcacacccccatgtacttcttcctcctcaacctctccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggggcaccagggccatctcctacacaggatgtgctgctcaggtctttttctttctcttcttcatctcggcagaatgttgccttctcaccatcatgtcttacgaccgctacgttgccatctgcaagcccctgcactacaggaccctgctgggcagcagagcttgtgccaccatggcagcagttgtctggggcactgggcttctctattccctgctgcacactgccaatacattttccctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctccttctcagatggctacctcagggaagctgggcttatcatagcttttgttcttgccgtatttgggtgttttgctttcattcttttctcctatgtgcaaatcttcagggccgtgctgaggatgctctttgagcagggacggcacaaagccttctccacctgcctcccccacctggccgtgctctccctgttggtcagcactgccatgtttgcctacctgaagcctccctccatctcctccccatccctggacctggtggtgtcatttctgtactcagtgatgcctccagcactgaatcccctcatctacggcatgaggaaccaggagctcaagggtgccctcaggaagatactccaacataccctgtttcgccatcagaaatatgttcatcatgatctcaagactacaaaaaatttagaaaaagcctga
MGNYGPDSLILVPGLHAHELRMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHHLHTPMYFFLLNLSLLDLGCISTTLPKAMANALWGTRAISYTGCAAQVFFFLFFISAECCLLTIMSYDRYVAICKPLHYRTLLGSRACATMAAVVWGTGLLYSLLHTANTFSLPLCQGNAVDQFFCEIPQILKLSFSDGYLREAGLIIAFVLAVFGCFAFILFSYVQIFRAVLRMLFEQGRHKAFSTCLPHLAVLSLLVSTAMFAYLKPPSISSPSLDLVVSFLYSVMPPALNPLIYGMRNQELKGALRKILQHTLFRHQKYVHHDLKTTKNLEKA
Other categories referring to ORL9368
Revisions: 1
Last Time: 3/21/2008 11:27:06 AM
Reviewer: CC student
Owner: CC student