SenseLab
Chemosensory Receptors
  Data
ORL9371
PREDICTED: Gallus gallus similar to olfactory receptor MOR220-1 (LOC426526), mRNA
atgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcaggatgtgctgcacagctctttctgtttgcctttctgctatcagcagaatattcccttctcaccatcatggcctatgaccgctacatggccatctgcaagcccctgcactacgggaccctgctgggcaacagagcttgtgccaccatggcagcagctgcctggggctctgggcttctctattccctgctgcacactgccaacacattttccctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctcctgctcagaatcctatctcagcgaatttgggcttattatgcttagtgcccttatattctttgggtgttttgctttcattcttttctcctatgtgcagatcttaagggccgtgctgaggatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggccgtggtctccctgtttctcagcactgtcgtgtttgcctacctgaagcccttctccatttcctccccatttctggatctgacagtggcacttctttactcagtgattcctccaacactgaaccctattatctacagcatgaggaacaaggagatcaagcatgccctcagcaaagtgttgcaatgtgcacgattccagcttcaataa
MPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCAAQLFLFAFLLSAEYSLLTIMAYDRYMAICKPLHYGTLLGNRACATMAAAAWGSGLLYSLLHTANTFSLPLCQGNAVDQFFCEIPQILKLSCSESYLSEFGLIMLSALIFFGCFAFILFSYVQILRAVLRMPSEQGRHKAFSTCLPHLAVVSLFLSTVVFAYLKPFSISSPFLDLTVALLYSVIPPTLNPIIYSMRNKEIKHALSKVLQCARFQLQ
Other categories referring to ORL9371
Revisions: 1
Last Time: 3/21/2008 11:32:35 AM
Reviewer: CC student
Owner: CC student