SenseLab
Chemosensory Receptors
  Data
ORL9373
PREDICTED: Gallus gallus similar to olfactory receptor, family 5, subfamily U member 1 (LOC430853), mRNA
atgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccagggccatctcctacgcaggatgtgctgcacaggtctttttctttctcttcttcatctcgtctgaatattccattctcactatcatgtcctacgaccgctatgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcaccggggttctctattccctgatgcacactgccagtgtattttcactgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaggctctcctgctcagaatcagaatttctaagggaacttggactcctcagtactagtgcatttattggtgttggatgttttgtcttcattgttgtgtcctatgtgcagatcttcagggccgtgctgaggatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggccgtggtctctctgtttctcagcactggcatggctgcctacctgaggccttcctctatctcctccccattcctggacctggtggtttcatttatgtactcagttgttcctccaacgctgaaccctattatctacagcatgaggaaccaggagctcaaaaattctctgtggaaactgatgacccgctgcattatgaaaacaatgaactgttcctcttga
MPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRAISYAGCAAQVFFFLFFISSEYSILTIMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGVLYSLMHTASVFSLPLCQGNAVDQFFCEIPQILRLSCSESEFLRELGLLSTSAFIGVGCFVFIVVSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVVSLFLSTGMAAYLRPSSISSPFLDLVVSFMYSVVPPTLNPIIYSMRNQELKNSLWKLMTRCIMKTMNCSS
Other categories referring to ORL9373
Revisions: 1
Last Time: 3/21/2008 11:37:49 AM
Reviewer: CC student
Owner: CC student