SenseLab
Chemosensory Receptors
  Data
ORL9374
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC430804), mRNA
atgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagctgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctgggacaccaggcacatctcctatgcaggatgtgctgcacaggtctttttctttctcttcttcctctcagcagaatattccattctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccagcatggcagcagctgcctggggcactgggcttctctattccctgctgcatactgccaatacattttcactgcctctctgccatggcaatgttgtagatcagttcttctgtgaaatcccccacatcctcaagctctcctgctcagatgcctacctcagagaagttgcatttattgtacttggtgtccttgtctttgttgggtgttttgctttcattcttttctcctatgtgcatgttttcagggccgtgctgaggatgccctctgagcagggacagcacaaagccttctccatgtgcctccctcacctggccgtgctctccctgttagtcagcactgccacatttgccaacctaaagcctcccgccttctcttctgcatccatgaacttggtggtgtcatttctgtactctgtggtgcctccagcactgaaccccgtcatctacagcatgaggaaccaggagttaagagacacattggggaaattgatgtcatggacaattttcattaacaataaacttctgatctcttgctaa
MPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWDTRHISYAGCAAQVFFFLFFLSAEYSILTIMSYDRYVAICKPLHYGTLLGSRACASMAAAAWGTGLLYSLLHTANTFSLPLCHGNVVDQFFCEIPHILKLSCSDAYLREVAFIVLGVLVFVGCFAFILFSYVHVFRAVLRMPSEQGQHKAFSMCLPHLAVLSLLVSTATFANLKPPAFSSASMNLVVSFLYSVVPPALNPVIYSMRNQELRDTLGKLMSWTIFINNKLLISC
Other categories referring to ORL9374
Revisions: 1
Last Time: 3/21/2008 11:40:09 AM
Reviewer: CC student
Owner: CC student