SenseLab
Chemosensory Receptors
  Data
ORL9375
PREDICTED: Gallus gallus similar to olfactory receptor, family 5, subfamily U member 1 (LOC430792), partial mRNA
gactccaagcccaggaaccgcagatgcccaacagcagctccatcagtgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcaggatgtgctgcacaggtcttcttgtttctattcttctttggatcagagtattgcattctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcactgggcttctctattctctgctgcacactgccagtacattttctctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctcctgctcaggatcagaatttctaagggaacttggactccttagtactagtgcctttattggtgttggatgttttgttttcattgttgtgtcctatgtgcagatcttcagggctgtgctgcgaataccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggctgtggtcaccctgtttctcagcactgccttctttgccaatctgaggcccccctctctttcctcccaagccctggatctgacgatggcagttctgtactcggtggtgcctccaaccctgaaccccctcatctacagcatgaggaaccaggagctcaaggatgcagtgaggaaaatgatatcatggactcatttcagcagggataagcttctcatctgtctctacaaatga
LQAQEPQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCAAQVFLFLFFFGSEYCILTIMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGLLYSLLHTASTFSLPLCQGNAVDQFFCEIPQILKLSCSGSEFLRELGLLSTSAFIGVGCFVFIVVSYVQIFRAVLRIPSEQGRHKAFSTCLPHLAVVTLFLSTAFFANLRPPSLSSQALDLTMAVLYSVVPPTLNPLIYSMRNQELKDAVRKMISWTHFSRDKLLICLYK
Other categories referring to ORL9375
Revisions: 1
Last Time: 3/21/2008 11:42:18 AM
Reviewer: CC student
Owner: CC student