SenseLab
Chemosensory Receptors
  Data
ORL9376
PREDICTED: Gallus gallus similar to olfactory receptor Olfr305 (LOC426342), mRNA
atgaataatgcatgtatcctgcatacaggcagctttctctcacagaaattgaagggcacagagtttgggcttctgggctctaagagcagttggggactccatgcccaggaactgcagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatggacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccagggccatctcctacgcaggatgtgctgcacaggtcttcttctttgtcttcttcctctcagcagaatattgccttctcaccatgatgtcctatgaccgctatgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagcagcctggggcattggattctttaattcactgcttcacactgccagtacattctcactgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctcctgctcaaaatccttcaaatcctacctcagggaagttgggtttctcctttttagtgtctgtttagccttagtgttttttgtcttcattgtattgtcctacgtacagatcttcagggccgtgctgaggatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggccgtggtctccctgtttctcagcactggctcttttgcccaaatgaagcccttctccaactcctccccattcctggatctgatggtgtcatttctgtattctgttctccctccaaccctgaaccctataatctacagcatgaggaacaaggagatcaagcatgccctcagtaaagtgttgcaaaatgtgcactattccagcttcaataaagtgcgcatctgcctcacatga
MNNACILHTGSFLSQKLKGTEFGLLGSKSSWGLHAQELQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMDFFLLNLALLDLGCISTTLPKAMANALWHTRAISYAGCAAQVFFFVFFLSAEYCLLTMMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGIGFFNSLLHTASTFSLPLCQGNAVDQFFCEIPQILKLSCSKSFKSYLREVGFLLFSVCLALVFFVFIVLSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVVSLFLSTGSFAQMKPFSNSSPFLDLMVSFLYSVLPPTLNPIIYSMRNKEIKHALSKVLQNVHYSSFNKVRICLT
Other categories referring to ORL9376
Revisions: 1
Last Time: 3/21/2008 11:44:00 AM
Reviewer: CC student
Owner: CC student