SenseLab
Chemosensory Receptors
  Data
ORL9377
PREDICTED: Gallus gallus similar to Olfactory receptor 125 (LOC430736), mRNA
atgtcgtgttattctgctgaccaaatggatgagctcacaacagaagagccagaccttcctctctgctcggtcacccatgtagttgacccagggaagccagttgatgttatccttgaggacttcagtagagcttttgatactgttcctcacagtatccgcctggacacaatgtatgcatacggcatagacagaaacataatgagtggatgggtcacccatgaagtagaccaaaggaagccagttgatgttatccttgaggacttcagtagagcttttgatactgttcctcacagtatccgcctggacacaatgtatgcatacggcatagacagaaacataatgagtggatgggttcttgcgcccacaggtccgggtgcccagaagtcccagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgcccacctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctgggacaccagggccatctcctacgcaggatgtgctgcacaggtcttcttctttcttttcttgtttggcgcagagtattcccttctcatagtcatgtcctatgactgctacgttgccatctgcaagcccctgcactacaggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcactgggcttgtctattccctgatgcacactgccactatattttccctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatccttaagctctcctgctcagattcctacctcagagaaatttgggttcttggggtcagtgcttgtttagcatctgggtgttttgctttcattcttttctcctatgtgcagatcttcagggctgtgctgaggatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggccgtggtctccctgtttctcaacactgccatttttgccaatctgaggcccctctctctttcctcccaagccctggatctggcaatggcagttctgtactcggtggtgcctccaaccctgaaccccctcatctacagcatgaggaaccaggagctcaagaatgcagtgaggaaggtgatatcctggacttaccagaagcaccctggaactcagtgcccagctgtgctgtgctcaccttgcctggctcccatgtgccccctatgctgctctgtcactgcccctcctcaacggaatgggggataa
MSCYSADQMDELTTEEPDLPLCSVTHVVDPGKPVDVILEDFSRAFDTVPHSIRLDTMYAYGIDRNIMSGWVTHEVDQRKPVDVILEDFSRAFDTVPHSIRLDTMYAYGIDRNIMSGWVLAPTGPGAQKSQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAAHLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWDTRAISYAGCAAQVFFFLFLFGAEYSLLIVMSYDCYVAICKPLHYRTLLGSRACATMAAAAWGTGLVYSLMHTATIFSLPLCQGNAVDQFFCEIPQILKLSCSDSYLREIWVLGVSACLASGCFAFILFSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVVSLFLNTAIFANLRPLSLSSQALDLAMAVLYSVVPPTLNPLIYSMRNQELKNAVRKVISWTYQKHPGTQCPAVLCSPCLAPMCPLCCSVTAPPQRNGG
Other categories referring to ORL9377
Revisions: 1
Last Time: 3/21/2008 11:45:49 AM
Reviewer: CC student
Owner: CC student