SenseLab
Chemosensory Receptors
  Data
ORL9380
PREDICTED: Gallus gallus similar to olfactory receptor 5 (LOC430699), mRNA
atgtgcactggattccagaagcacggttgtttgtaccacaagaagtttgaccatgagagaagtaaaagccgaatctggaaacctctgcgcatgacccgactccatgcccaggaactgcaaatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaaccttgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcaggatgtgctgcacaggtctttttctatgacttcttcatctcggcagaatattccattctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactatgggaccatgctgggtggcacagcttgtgccaccatggcagcagctgcctggggcactgggcttctctttttactgctgcacactgccaatacattctcactgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccacatcctcaagctctcctgctcagacgcgtacctcagggaagttgggcttattgtggctttttttcatgtcttatttgggtgctttgtcttcattgttgtgtcctatgtgcagatcttcagggccgtgctgaggatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggctgtggtctccctctttgtcagcactaccacatttgcgtatctgaagcccccctctatctcctccccatccctgaacctgctggtgtctgttctgtattcggtagtgcctccagcactgaaccccctcatctacagcatgaggaaccaggagctcaagggtgccctctggaagatactccaacataccctgtttcactatcagaaagatgttcatcatgctctcaagactacagaaaatttaggaaaagcctga
MCTGFQKHGCLYHKKFDHERSKSRIWKPLRMTRLHAQELQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCAAQVFFYDFFISAEYSILTIMSYDRYVAICKPLHYGTMLGGTACATMAAAAWGTGLLFLLLHTANTFSLPLCQGNAVDQFFCEIPHILKLSCSDAYLREVGLIVAFFHVLFGCFVFIVVSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVVSLFVSTTTFAYLKPPSISSPSLNLLVSVLYSVVPPALNPLIYSMRNQELKGALWKILQHTLFHYQKDVHHALKTTENLGKA
Other categories referring to ORL9380
Revisions: 1
Last Time: 3/21/2008 11:51:11 AM
Reviewer: CC student
Owner: CC student