SenseLab
Chemosensory Receptors
  Data
ORL9381
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC430596), mRNA
atggcagagcagccaggtcagagtgaatggaaatggccaacacaggagactaacagtgtccattcctggcttcctgatcaggaagagcatgtggaagatgttctccacagacagatgggaacggtagacctggaaccacagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccagggccatctcctacgcaggatgtgctgctcaggtctttttctttgtcttcttcatctcggcagaatattctattctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactacggaaccctgccgggcagcagagcttgtgccaccatggcagcagctgcctggggcactgggcttctctattccctgctgcacactgccaatacattttcactgcctctctgccaaggcaatgctgtggatcaattcttctgtgaaattgcccatatcctcaagctctcctgttccaaatcctacctcagggaagtgggactcattgtgctaagtgtccttgtgtttttagggtgttttgtcttcattgttgtgtcctatgtgcagatcttcagggctgtgctgaggatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggccgtgctctccctcttagtcagcactgtagtgtttgcatacctgaagccatcctctatttcctccccatccctggacctggtggtgtcatttctgtactcagtggtgcctccagctgtgaaccccctcatctatagcatgaggaaccagaagctcaaagtcacattggggaaactgatgtccagagctgactcttgtatcctctgtgtagtgtctctgtatctgcagggaaatgaggtgtctgcagtcttctctgtggcagtggggatatgctcgtatgaccaggagccctatgaccttgtggctgttcctcagtccccgctgtaa
MAEQPGQSEWKWPTQETNSVHSWLPDQEEHVEDVLHRQMGTVDLEPQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRAISYAGCAAQVFFFVFFISAEYSILTIMSYDRYVAICKPLHYGTLPGSRACATMAAAAWGTGLLYSLLHTANTFSLPLCQGNAVDQFFCEIAHILKLSCSKSYLREVGLIVLSVLVFLGCFVFIVVSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVLSLLVSTVVFAYLKPSSISSPSLDLVVSFLYSVVPPAVNPLIYSMRNQKLKVTLGKLMSRADSCILCVVSLYLQGNEVSAVFSVAVGICSYDQEPYDLVAVPQSPL
Other categories referring to ORL9381
Revisions: 1
Last Time: 3/21/2008 11:52:34 AM
Reviewer: CC student
Owner: CC student