SenseLab
Chemosensory Receptors
  Data
ORL9383
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC430544), mRNA
atgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcaggatgtgctacccagtttttcttctttcttttcctgtttggagcagagtattgcattctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactatgggaccttgatggacagcagagcttgtgccaccacggcagcggctgcctggggctctgggcttctctattccctactgcacactgccagtacgttttctcaagcactgtgccgaggtaaagctgtgaaccagttcttctgtgaaatcccccacatcctcaagctctcctgctcagaatcagactacctccgggaaactggatttattgtggttactgtgcttgccttatttgggtgttttgttttcattcttttctcctatgtgcagatcttcagggccgtgctgatgatgccctctgagcagggacggcacaaagccttctccatgtgcctcccccacctggccgtggtctccctctttgtcagcactgactttctggcctacctgaaaccccattccctggtctccccatccctggacctggtggtgtcatttttgtactcggtggtgcctccaacactgaaccccctcatctacagcatgaggaaccaggagctcaaggatgcagtgaggaaaattatgtcatggacacatttcagcagcaataaacttctcatctgtctttacaaatga
MPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCATQFFFFLFLFGAEYCILTIMSYDRYVAICKPLHYGTLMDSRACATTAAAAWGSGLLYSLLHTASTFSQALCRGKAVNQFFCEIPHILKLSCSESDYLRETGFIVVTVLALFGCFVFILFSYVQIFRAVLMMPSEQGRHKAFSMCLPHLAVVSLFVSTDFLAYLKPHSLVSPSLDLVVSFLYSVVPPTLNPLIYSMRNQELKDAVRKIMSWTHFSSNKLLICLYK
Other categories referring to ORL9383
Revisions: 1
Last Time: 3/21/2008 11:56:05 AM
Reviewer: CC student
Owner: CC student