SenseLab
Chemosensory Receptors
  Data
ORL9384
PREDICTED: Gallus gallus similar to olfactory receptor MOR104-3 (LOC430536), mRNA
atggttgctacagcccaggcagcctccaatcctgatgtcaccaatcggttcatttatatgggtaagcagcaggtccagtactgcataccccctgatgaactggagttggccatgggacaaggaaatgaaactgtcgttactgaattcatcctcgagggtttctcagggcttaatcaaaggctacagctatttctctctctggtctttctactcatctacctgacagcggtgatggggaatgcaaccatcattttcctcgtgtgtgtggataaccgcctgcaaatccctatgtactttttcattggcaatctggcattcctggaaatctgctttacatcctgcacaagcatcaaattgttggtgattctgagctctggcaggagaacaatctctgtaagtgcctgctttgtccagtcccatttctactttgccctgggatgtacggagtttattctccttgtggtcatgtcctttgaccgttaccttgccatctgccagcctttgcgctatgctgccatcatgacgcagcagctctgcatcctcctggttgttgctgcttgggtcgcaggcttcacattcatgagttaccacctggtactgctctcaaagctcacgttctgtggttcaaacaagatccagcactttttttgtgacaactcccccttgttccagctgtcctgctctgacaccaacttgctctggagaatagactccgttttgatcctgttcattctgctgggttcattgtgtttaactctgtcatcttatgtgtgcatcttgttctgtattctacgcatgccttccaggaggaaaaaagcttttgctacttgttcttcccatctcaccagcttggccattgtatttggaagctgccttgatctctattcacatccctcggaacgtgtttctttggagaccaacaaacttgtggctttactgaacactgtcctgtacccgttcttaaaccctttcatctacagccttagaaacaagcttgtggtgctggtcctgaaggatgccattgcccatgcaacagcacagcttttccctcagtcacgatgcatttctggacagtaa
MVATAQAASNPDVTNRFIYMGKQQVQYCIPPDELELAMGQGNETVVTEFILEGFSGLNQRLQLFLSLVFLLIYLTAVMGNATIIFLVCVDNRLQIPMYFFIGNLAFLEICFTSCTSIKLLVILSSGRRTISVSACFVQSHFYFALGCTEFILLVVMSFDRYLAICQPLRYAAIMTQQLCILLVVAAWVAGFTFMSYHLVLLSKLTFCGSNKIQHFFCDNSPLFQLSCSDTNLLWRIDSVLILFILLGSLCLTLSSYVCILFCILRMPSRRKKAFATCSSHLTSLAIVFGSCLDLYSHPSERVSLETNKLVALLNTVLYPFLNPFIYSLRNKLVVLVLKDAIAHATAQLFPQSRCISGQ
Other categories referring to ORL9384
Revisions: 1
Last Time: 3/21/2008 11:57:27 AM
Reviewer: CC student
Owner: CC student