SenseLab
Chemosensory Receptors
  Data
ORL9387
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC430494), partial mRNA
gactccatgcccaggaaccgcagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacacaggatgtgctgcacaggtctttttctttgacttcttcatctcttcagagtattcccttctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctgggccactggggtccttaattccctgctgcacactgccaatacattttctatcccactctgccaaggcaatgctgtgaatcaattcttctgtgaaatcccccacatcctcaagctctcctgctcagatgcctacctcagggaagttgggctcatcatggctggtgttcttgtcttttttgggtgctttgctttcattcttttcttctacgtgcagatcttcagggccgtgctgaggatgccctctgagcagggacggcacaaagccttctccacgtgcctgcctcacctggccgtgctctccctgttggtcagcactgccatatttgcctacctgaagcctccctccatctcctccccatccctggacctggtggtgtcatttctgtactcagtgatgcctccagcattgaatcccctcatctatggcatgaggaaccaggagctcaagggtgcccttaggaagatactccaacataccctgtttcactatcagaaagatgttcatcatgctctcaagactacaaaacatttaggaaaagcctga
LHAQEPQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYTGCAAQVFFFDFFISSEYSLLTIMSYDRYVAICKPLHYGTLLGSRACATMAAAAWATGVLNSLLHTANTFSIPLCQGNAVNQFFCEIPHILKLSCSDAYLREVGLIMAGVLVFFGCFAFILFFYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVLSLLVSTAIFAYLKPPSISSPSLDLVVSFLYSVMPPALNPLIYGMRNQELKGALRKILQHTLFHYQKDVHHALKTTKHLGKA
Other categories referring to ORL9387
Revisions: 1
Last Time: 3/21/2008 12:03:02 PM
Reviewer: CC student
Owner: CC student