SenseLab
Chemosensory Receptors
  Data
ORL9388
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC430470), mRNA
atgcccaacagtagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccagggccatctcctacgcaggatgtgctgcacaggtctttctgtttgtttttctcatgtcaacagaatattctgtcctcacggtcatgtcctatgaccgctacgttgccatctgcaagcccctgcactatgggaccctgctgggcagcagagcttgtgccaccatggcagtagctgcctggggcacgggggttctctattccctgctgcacactgccaatacattttcactgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctcctgctcagatgcttacctcagggaagctgggcttattgcctttagtgtcgctatggagtttgggtgtttcatcttcattgttgtgtcctatgtgcagatcttcagggccgtgttaaggatgccctctgagcagggacggcacaaagccttctccacatgcctccctcatctggccgtgctctccctgtttctcagcactggtatgattgcctatttgaagccccactctgtctcctccccctctctggatatcgtggtttcatttctgtactcagtggtgcctccagcactgaaccccctcatctacagcatgaggaaccaggagctcaaggatgctctgtggaaactgatgaccaaacgtcttttgaaagcaatgaactgcccatgtttatctatatag
MPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRAISYAGCAAQVFLFVFLMSTEYSVLTVMSYDRYVAICKPLHYGTLLGSRACATMAVAAWGTGVLYSLLHTANTFSLPLCQGNAVDQFFCEIPQILKLSCSDAYLREAGLIAFSVAMEFGCFIFIVVSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVLSLFLSTGMIAYLKPHSVSSPSLDIVVSFLYSVVPPALNPLIYSMRNQELKDALWKLMTKRLLKAMNCPCLSI
Other categories referring to ORL9388
Revisions: 1
Last Time: 3/21/2008 12:05:18 PM
Reviewer: CC student
Owner: CC student