SenseLab
Chemosensory Receptors
  Data
ORL9390
PREDICTED: Gallus gallus similar to olfactory receptor 5 (LOC430452), partial mRNA
atggcaagagggtcgtgctattccaacaatctagacatcatttgcagatccaagacaaaatacaatcatgatgctgttgtctttcaggagctgttggccatggagacccagggaattctcagggaacgactccatgccctggaactgcagatgcccaacagcagctccatcagcgagttcctcctcctggcattggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccagggccatctcctacgcaggatgtgctgctcaggtctttttctttgtctttttcctctcaacagaatattcccttctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctacactacaggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggctctgggcttctctattccttgctgcacactgccactgcattttcagtacctctctgccaaggcaatgctgtggatcagttcttctgtgaaatccctcagatcctcaagctctcctgctcaaaatctgactacttcagggaaattgggattatttattttagtctttgtttatcatttgggtgctttgtattcattgttgtgtcgtatgtgcagatcttcagggctgtgctgaggatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggccgtgctttccctgtttctcagcacagccatgttggcctatctgaaacccccgtccatctcttctccatccctggacctgctggtttcatttctgtactcagtggtgcctccagcagtgaatcctcttatctacggcttgagaaaccaggagctcaaggctgcatctcacaggagtctcgag
MARGSCYSNNLDIICRSKTKYNHDAVVFQELLAMETQGILRERLHALELQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRAISYAGCAAQVFFFVFFLSTEYSLLTIMSYDRYVAICKPLHYRTLLGSRACATMAAAAWGSGLLYSLLHTATAFSVPLCQGNAVDQFFCEIPQILKLSCSKSDYFREIGIIYFSLCLSFGCFVFIVVSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVLSLFLSTAMLAYLKPPSISSPSLDLLVSFLYSVVPPAVNPLIYGLRNQELKAASHRSLE
Other categories referring to ORL9390
Revisions: 1
Last Time: 3/21/2008 12:08:41 PM
Reviewer: CC student
Owner: CC student