SenseLab
Chemosensory Receptors
  Data
ORL9393
PREDICTED: Gallus gallus similar to olfactory receptor, family 5, subfamily U member 1 (LOC425951), mRNA
atgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacacaggatgtgctgcacaggtctttttctttctcttcttcctcacagcagagtattcccttctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcactgggcttctctattccctgctgcacactgccaatacattttccctgcctctgtgccacggcaatgctgtggatcagttcttctgtgaaatcccccagatccttaagctctcctgctcagatgcctacctcagagaaatttggcttcttggggtcagtgcttctttagtatctgggtgttttgcttttattctcttctcctatgtgcagattttcagggccgtgctgaggatgccctctgagcaggggcggcacaaagccttctccatgtgcctccctcacctggctgtggtatccctgtttctcagcactgcctttgttgccaatctgaagcccccctctctttcctcccaatccctggacctgacaatggcagttctgtattcggtggtacctccaaccctgaaccctctcatctacagcatgaggaaccaggagctcaaggattcaatgaggaagatgatagcatgggctcatttcagcagggataaacttctcatctgtctctacaaatga
MPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYTGCAAQVFFFLFFLTAEYSLLTIMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGLLYSLLHTANTFSLPLCHGNAVDQFFCEIPQILKLSCSDAYLREIWLLGVSASLVSGCFAFILFSYVQIFRAVLRMPSEQGRHKAFSMCLPHLAVVSLFLSTAFVANLKPPSLSSQSLDLTMAVLYSVVPPTLNPLIYSMRNQELKDSMRKMIAWAHFSRDKLLICLYK
Other categories referring to ORL9393
Revisions: 1
Last Time: 3/21/2008 12:14:11 PM
Reviewer: CC student
Owner: CC student