SenseLab
Chemosensory Receptors
  Data
ORL9394
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC425918), mRNA
atgtcgtgttattctgtggagagcttctgggaccgggagcactggctccgggagaggggccatgatgggatgcagctggcaggtcactatgcccagaagcagcagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcagcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgctctctggcacaccagggccatctcctatgcaggatgtgctgcacaggttttttttttcttctttttgttttcagcagagtattccattctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactatgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcactgggcttctctatgctgtgttgcacactgctaatacattttccctgcctctctgccaaggtaatgctgtggatcaattcttctgtgaaatcccccacatcctcaagctctcctgctcacagtcatatctcaaggaaattgggcttattgcgcttagtgtccttgtgttttttggcagttttgtcttcattgtagtgtcctatgtgcagatcttcagagccgtgctgaggatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggccgtggtcttcctgttcctcagcactggcatgtttgcctatctgaagcctccctccatctcttccacttccctggatctggtggtggctgttctgtactcagtggtgcctccagcagttaaccctattatctatagtatgaggaaccagttgctcaaggatgctctgtgggaactgatggccaaatgtcttttgaaagcaatgaactgcccatgtttatatatgtag
MSCYSVESFWDREHWLRERGHDGMQLAGHYAQKQQMPNSSSISEFLLLALADTQQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRAISYAGCAAQVFFFFFLFSAEYSILTIMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGLLYAVLHTANTFSLPLCQGNAVDQFFCEIPHILKLSCSQSYLKEIGLIALSVLVFFGSFVFIVVSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVVFLFLSTGMFAYLKPPSISSTSLDLVVAVLYSVVPPAVNPIIYSMRNQLLKDALWELMAKCLLKAMNCPCLYM
Other categories referring to ORL9394
Revisions: 1
Last Time: 3/21/2008 12:15:50 PM
Reviewer: CC student
Owner: CC student