SenseLab
Chemosensory Receptors
  Data
ORL9395
PREDICTED: Gallus gallus similar to olfactory receptor 5 (LOC430334), mRNA
atgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcaggatgtgctgcacaggtctttttctttctgttcttcatctcggcagaatattttcttctcactgtgatgtcctatgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggctctgggcttctctatgctctgctgcacactgcctacacattttccctgcctctgaggcaaggcaatgctgtggatcagttcttctgtgaaattgcccagatcctcaagctctcctgctcaaaatctgactacctcagtgaagttgggattatttattttagtctttgtttaatctgtgggtgttttgctttcattcttttctcctatgtgcagatcttcagggccgtgctgaggatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggctgtggtctccctctttgtcagcacagccatgtttgcctatctgaaacccccctccatctcttctccatccctggacctgctggtttcatttctgtactcagtggtgcctccagcagtgaatcctctcatctacggcttgaggaaccaggagctcaaggctgcagtgaggctcatcctgagcaaggtggctactgccttgtgttttgccttcattgtgctgtcctgcgtgcagatcttcaggaccggaaatgaggtgtctgcagtcttcactgtggcagtggggatgtaccgctgtatggaagggagggattcctgtcattcttgctgtgcctga
MPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCAAQVFFFLFFISAEYFLLTVMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGSGLLYALLHTAYTFSLPLRQGNAVDQFFCEIAQILKLSCSKSDYLSEVGIIYFSLCLICGCFAFILFSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVVSLFVSTAMFAYLKPPSISSPSLDLLVSFLYSVVPPAVNPLIYGLRNQELKAAVRLILSKVATALCFAFIVLSCVQIFRTGNEVSAVFTVAVGMYRCMEGRDSCHSCCA
Other categories referring to ORL9395
Revisions: 1
Last Time: 3/21/2008 12:17:39 PM
Reviewer: CC student
Owner: CC student