SenseLab
Chemosensory Receptors
  Data
ORL9397
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC425904), mRNA
atgtccagggggagcagtgtggaagagaaaatcacatcctcggcacctgagctgggccaggctccagggacacagatagctcatacaagactccatggccaggaaccgcagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccacctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggggcaccagggccatctcctacgcaggatgtgctgcacaggtctttttctttgtcttcttcatctcagcagagtactgcattctcactatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagatcttgtgccaccatggcagcagctgcctggggcactgggcttctctatgctctgctgcacactgccaatacattttccctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctcctgctcagaatcctatctcagggaagttgggttactcctttttagtgtctgtgcatgtcttgggtgttttgtcttcattgttgtgtcctatgtgcagatcttcagggccgtgctaaggatgccctctgagcaggggcggcacaaagccttctccatgtgcctccctcacctggccgtggtctctctgtttgtcggcacaggcttttttgcctacgtgaagcccccgtctatctcctccccattcatagatctgacagttgcacttctgtactctgtggttcctccaacactgaaccctattatctacagcatgaggaacaaggagatcaagcatgccctccggaaactgttgcaatatgtgcactattccagcttcaataaagtgcccatcttcctcacgtga
MSRGSSVEEKITSSAPELGQAPGTQIAHTRLHGQEPQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHHLHTPMYFFLLNLALLDLGCISTTLPKAMANALWGTRAISYAGCAAQVFFFVFFISAEYCILTIMSYDRYVAICKPLHYGTLLGSRSCATMAAAAWGTGLLYALLHTANTFSLPLCQGNAVDQFFCEIPQILKLSCSESYLREVGLLLFSVCACLGCFVFIVVSYVQIFRAVLRMPSEQGRHKAFSMCLPHLAVVSLFVGTGFFAYVKPPSISSPFIDLTVALLYSVVPPTLNPIIYSMRNKEIKHALRKLLQYVHYSSFNKVPIFLT
Other categories referring to ORL9397
Revisions: 1
Last Time: 3/21/2008 12:21:06 PM
Reviewer: CC student
Owner: CC student