SenseLab
Chemosensory Receptors
  Data
ORL9398
PREDICTED: Gallus gallus similar to Olfactory receptor 125 (LOC425837), mRNA
atgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctgggacaccagggacatctcctacgcaggatgtgctgcacaggtctttttctttgtcttcttcatcttggcagaacattccattctcaccatcatgtcctatgatcgctacgttgccatctgcaagcccctgcactacaggaccctgctgtgcagcagagcttgtgccaccatggcagcagctgcctggggcactgggattctccattccctgctgcatactgccagtacattttccctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccacatcctcaagctctcctgctcagattcgtacctcagagaaatttggcttcttggggtcagtgcttctttagtatctgcgtgttttgttttcattcttttctgctatgtgcagatcttcagggccgtgctgcggataccctctgagcagggacggcacaaagccttctccacgtgcctccctcacccggctgtggtcaccctttttctcagcactgccttctttgccggtctgaggcccccctctctttcctcccaagccctggatctgacgatggcagttctgtattcggtggtgcctccaaccctgaaccccctcatctacagcatgacgaaccaggagctcaaggatgcagtgaggaaaatgatatcatggactcatttcagtagggataaacttctcatctgtctctgcaaatga
MPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWDTRDISYAGCAAQVFFFVFFILAEHSILTIMSYDRYVAICKPLHYRTLLCSRACATMAAAAWGTGILHSLLHTASTFSLPLCQGNAVDQFFCEIPHILKLSCSDSYLREIWLLGVSASLVSACFVFILFCYVQIFRAVLRIPSEQGRHKAFSTCLPHPAVVTLFLSTAFFAGLRPPSLSSQALDLTMAVLYSVVPPTLNPLIYSMTNQELKDAVRKMISWTHFSRDKLLICLCK
Other categories referring to ORL9398
Revisions: 1
Last Time: 3/21/2008 12:23:28 PM
Reviewer: CC student
Owner: CC student