SenseLab
Chemosensory Receptors
  Data
ORL9399
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC430228), mRNA
atgaagtataacaagaacaagggactgatttcgcacctgggactccatgcccaggaactgcagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctggcctacatctccactactatcccccaagccatggccaatgccctctgggacaccagggccatctcctacgcaggatgtgctgcacaggtctttttctctgttttcttcttctcagcagagtattgcattctcaccatgatgtcctatgaccgctacgttgccatctgcaaacccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcactgggcttctctattccctgctgcacactgccaatacattctcactgcctctctgccaaggcaatgttttggatcagttcttatgtgaaatccctcagatcctcaagctcacctgctcagatgcctacctcaaggaagctgggcttattgtgattagtgtccttgtaatatttgggtgttttgttttcattgttgtatcctatgtgcagatcttcagggccgtgctgaggatgccctctgagcagggacggcacaaagccttctccatgtgcctccctcacctggctgtgctctcccttcttatcagctctgcctcttttgcctacttgaaacccccctccatctccaccccattcctgaacctggtggtgtcatttctgtactcagtggtgcctccaaccctgaaccccctcatctacagcatgaggaaccaggagctcaaggatgctctggggaaactgatgaccggttgtattttgaaagcaatgtactgcccatctttatctattcatgacttgtaa
MKYNKNKGLISHLGLHAQELQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLAYISTTIPQAMANALWDTRAISYAGCAAQVFFSVFFFSAEYCILTMMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGLLYSLLHTANTFSLPLCQGNVLDQFLCEIPQILKLTCSDAYLKEAGLIVISVLVIFGCFVFIVVSYVQIFRAVLRMPSEQGRHKAFSMCLPHLAVLSLLISSASFAYLKPPSISTPFLNLVVSFLYSVVPPTLNPLIYSMRNQELKDALGKLMTGCILKAMYCPSLSIHDL
Other categories referring to ORL9399
Revisions: 1
Last Time: 3/21/2008 12:25:00 PM
Reviewer: CC student
Owner: CC student