SenseLab
Chemosensory Receptors
  Data
ORL9401
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC430138), mRNA
atgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggggcatcagggccatctcctacacaggatgtgctgctcaggtctttttctttctcttcttcatctcggcagaatgttgccttctcaccatcatgtcttacgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagttgcctggggcactgggcttctctatgctctgctgcacactgccaatacattttccctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctccttctcagatggctacctcagggaagctgggcttatcatagcttttgttcttgccgtatttgggtgttttgctttcattctcttctcctatgtgcaaatcttcagggccgtgctgaggatgctctttgagcagggacggcacaaagccttctccacctgcctcccccacctggccatgctctccctgttggtcagcactgccatgtttgcctacctgaagcctccctccatctcctccccatccctggacctggtggtgtcatttctgtactcagtgatgcctccagcactgaatcccctcatctacggcatgaggaaccaggagctcaagggtgccctcaggaagatactccaacataccctgtttcgccatcagaaagatgttcatcatgctctcaagactacaaaaaatttagaaaaagcctga
MYFFLLNLALLDLGCISTTLPKAMANALWGIRAISYTGCAAQVFFFLFFISAECCLLTIMSYDRYVAICKPLHYGTLLGSRACATMAAVAWGTGLLYALLHTANTFSLPLCQGNAVDQFFCEIPQILKLSFSDGYLREAGLIIAFVLAVFGCFAFILFSYVQIFRAVLRMLFEQGRHKAFSTCLPHLAMLSLLVSTAMFAYLKPPSISSPSLDLVVSFLYSVMPPALNPLIYGMRNQELKGALRKILQHTLFRHQKDVHHALKTTKNLEKA
Other categories referring to ORL9401
Revisions: 1
Last Time: 3/21/2008 12:28:43 PM
Reviewer: CC student
Owner: CC student