SenseLab
Chemosensory Receptors
  Data
ORL9402
PREDICTED: Gallus gallus similar to olfactory receptor, family 5, subfamily U member 1 (LOC430090), mRNA
atgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctatgcaggatgtgctgcacaggtcttctttttattattcttattttctacagagactttccttctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactacgggaccttgatggacatcagagcttgtgccaccatggcagcagctgcctggggcactggggttctccattccctgctgcacactgccaatacattttctatcccactctgccaaggcaatgctgtggatcagttcttctgtgaaatggcccaggtcctcaagctctcctgctcagaatcagactacctcagcgaagctgggattattgattttagcctttctttaatttttgggtgttttgttttcattgttgtgtcctatgtgcagatcttcagggccgtgctgagaatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacatattcgtggtctccctctttgtcagcactctcatgtttgcctacctgaagccctcctccctttcctccccttccctggacctggtggtggcagttctgtactcggtggttcctccaacactgaatcctctcatctacagcatgaggaaccaggagctcagggatgccctgaggaaactttgggaaatccccagcaatatcagaaaatattaa
MPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCAAQVFFLLFLFSTETFLLTIMSYDRYVAICKPLHYGTLMDIRACATMAAAAWGTGVLHSLLHTANTFSIPLCQGNAVDQFFCEMAQVLKLSCSESDYLSEAGIIDFSLSLIFGCFVFIVVSYVQIFRAVLRMPSEQGRHKAFSTCLPHIFVVSLFVSTLMFAYLKPSSLSSPSLDLVVAVLYSVVPPTLNPLIYSMRNQELRDALRKLWEIPSNIRKY
Other categories referring to ORL9402
Revisions: 1
Last Time: 3/21/2008 12:30:16 PM
Reviewer: CC student
Owner: CC student