SenseLab
Chemosensory Receptors
  Data
ORL9403
PREDICTED: Gallus gallus similar to olfactory receptor, family 5, subfamily U member 1 (LOC425690), mRNA
atgtggaatgtctcgtcattaaccttcctactccttggacaggttcttgtgctcacaggtcctggtgctcagctgtaccagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgccgcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctgggacaccacggccatctcctatgcagcctgtgttgcacaggtctttttctttctcttcttcctctcagcagaatattcccttctcaccatcatgtcctatgaccgctatgttgccatctgcaagcccctgcactacgggaccttgatggacagcagagcttgtgccactatggcaacagctgcctggggcagtgggcttctctattccctgctgcacactgccagtgtattttcagtgcctctgtgccaaggcaacgctgtggatcagttcttctgtgaaatcccccagatcctcaggctctcctgctcagaatcagaatttctaagggaacttggactcctcagtactagtgcctttattggtgttggatgttttgtcttcattgttgtgtcctatgtgcagctcttcagggctgtgctgaggataccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggccgtggtctctctgtttctcagcactggcatggctgcctacctgaggccttcctctatctcctccccattcctggacctggtggtttcatttatgtactcagttgttccaccaacgctgaaccctattatctacagcatgaggaaccaggagctcaaaaattctctgtggaaactgatgacccgctgcattatgaaaacaatgaactgttcctcttga
MWNVSSLTFLLLGQVLVLTGPGAQLYQMPNSSSISEFLLLALADTPQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWDTTAISYAACVAQVFFFLFFLSAEYSLLTIMSYDRYVAICKPLHYGTLMDSRACATMATAAWGSGLLYSLLHTASVFSVPLCQGNAVDQFFCEIPQILRLSCSESEFLRELGLLSTSAFIGVGCFVFIVVSYVQLFRAVLRIPSEQGRHKAFSTCLPHLAVVSLFLSTGMAAYLRPSSISSPFLDLVVSFMYSVVPPTLNPIIYSMRNQELKNSLWKLMTRCIMKTMNCSS
Other categories referring to ORL9403
Revisions: 1
Last Time: 3/21/2008 12:32:14 PM
Reviewer: CC student
Owner: CC student