SenseLab
Chemosensory Receptors
  Data
ORL9404
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC429854), mRNA
atgcatatatatgtctcactggtgtgtcagagggaagggtgccagggcaatacccgcacagaagtggtggaccacctgccctgtcacagtcggacagagctgagagaggaggaggacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcaggatgtgctgctcaggtcttcttctctctcctcttcatctcagcagaatactcccttcttaccatcatgtcctatgaccgctacgttgccatctgtaagcccctgcactacgggaccttgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcaccggggttctctattccctgctgcacactgccaatacattttccctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctcctgttcagactcctatctcagggaagttgggttactcctttttagtgtctgtgcatgtcttgggtgttttgtcttcattgttgtgtcctatgtgcagatcttcagggccgtgctgaggatgccctctgagcaggggcggaacaaagccttctccacgtgcctccctcacctggccgtggtctctctgtttgtcagcacaggcttttttgcctacgtgaagcccccctctatctcctccccattcatagatctgacagttgcacttctgtactctgtggttcctccaacactgaaccctattatctacagcatgaggaacaaggagatcaagcatgccctccgcaaactgttacaatatgtgcactattccagcttcaataaagtgcccatcttcctcacgtga
MHIYVSLVCQREGCQGNTRTEVVDHLPCHSRTELREEEDTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCAAQVFFSLLFISAEYSLLTIMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGVLYSLLHTANTFSLPLCQGNAVDQFFCEIPQILKLSCSDSYLREVGLLLFSVCACLGCFVFIVVSYVQIFRAVLRMPSEQGRNKAFSTCLPHLAVVSLFVSTGFFAYVKPPSISSPFIDLTVALLYSVVPPTLNPIIYSMRNKEIKHALRKLLQYVHYSSFNKVPIFLT
Other categories referring to ORL9404
Revisions: 1
Last Time: 3/21/2008 12:34:00 PM
Reviewer: CC student
Owner: CC student