SenseLab
Chemosensory Receptors
  Data
ORL9408
PREDICTED: Gallus gallus similar to olfactory receptor MOR0-2 like protein (LOC427948), mRNA
atggcggccgggtgccgtctgggcagcggcgtgcgagggggccgcgagatgccatgtgaaggatgcatggagagggacaatgagagcactgatgcaaccatggagttcctccttcttggcttctctgagctgttctgtctgcgggtcctcctcttccttatctttctcatcatccatttggtcacattggcagggaatatgatgatcttcatagctgtgtttatggagcactctcgtcctcccatgcttttcttcctctgtcagctctctatcattgagctttgctacaccttagtcattgtccctaaggcactccttggcctgatggttatgaatggcatcaccatttccttcataggctgcgctgcccagatgtaccttttcgtggggctcggtggagccgaatgctttctcctggcagccatgtcgtatgaccgctacattgccatctgccagccccttcactacacagtggtgatgagcgaggggctctgccttaggctgtccatagcgtgctgtctgggaggctttgctgttgccctggggttgacagtgtctgttttccacttacctttctgtcagtcacatcacatcaaccacttcttctgtgatgtccctgcagtgctgcacctggcctgcacacacagctacacccccgagcttcccctgctggctgcctgcgtgctcctcctgctacttcccttcctcctgatcctcacctcttatgtgtgtattgctgttgctttgctacgtatcacttcctccctcagaaggggcaaggccttttccacctgcttatcacacttgaccatcacgttgctgcactatggatgtgcctccttcatgtacattcgtcccaagtccagttactcaccagctcgagacaagatggtttctctagtctacaccaatattactccattactatacccccttatttatagcttgaggaacaaggaaatcagaggagtcctaaggaaaatgttgaggaggaagagaacagctcagctgaactggggtactactagggctgttacagctgagaactaa
MAAGCRLGSGVRGGREMPCEGCMERDNESTDATMEFLLLGFSELFCLRVLLFLIFLIIHLVTLAGNMMIFIAVFMEHSRPPMLFFLCQLSIIELCYTLVIVPKALLGLMVMNGITISFIGCAAQMYLFVGLGGAECFLLAAMSYDRYIAICQPLHYTVVMSEGLCLRLSIACCLGGFAVALGLTVSVFHLPFCQSHHINHFFCDVPAVLHLACTHSYTPELPLLAACVLLLLLPFLLILTSYVCIAVALLRITSSLRRGKAFSTCLSHLTITLLHYGCASFMYIRPKSSYSPARDKMVSLVYTNITPLLYPLIYSLRNKEIRGVLRKMLRRKRTAQLNWGTTRAVTAEN
Other categories referring to ORL9408
Revisions: 1
Last Time: 3/21/2008 12:41:34 PM
Reviewer: CC student
Owner: CC student