SenseLab
Chemosensory Receptors
  Data
ORL9409
PREDICTED: Gallus gallus similar to olfactory receptor MOR195-1 (LOC428815), mRNA
atgggatggacaaatcactccgtggtgacagagttcactcttgcggggttcggtgatcgccctgagctgcaggaagtgctccttgtggtgttcctcaccatgtacctcatcaacctagtgggaaatgtggggatgatcctcttaatccactgtgaacccaggctgcacgcccccatgtacttcttcctaagccacctgtccctcctggacatcagcttctcctccagcatcatcccaaagttcctcctcagcctcctgacagggagcagaaccatctcctacagaggatgtctcactcagctttacttctacgtcatgtttgccacagcagaatccttcctcctggcctccatggcatatgaccgctacgtggccatctgcaacccactccggtacacagtggtgatgtcccagggactgtgcctgcgcctggtggtcagctgctatgctgcaggggccctcaactccgctgtgcaaacggtggccatgcttcgcctctccttctgtgcctcccaccgcctggaccacttctactgtgaaggagcactgctctttgccctctcgtgctctgacaccagcatcaatgatgtcttgatgctcgtctttgccagctgcacggtgggcaccaccagcacggccacgctgctgtcctacggctgcatcctggccactgtgctgcagactcgctcccccagggccaggcataaggccatctccacctgtacctcccacctctcggtcactctcctcttctacggggcactcgccttcatgtacatgcggcctggagccaaaaggtcagtcaagctggacaaagtggcttccatcttctacactgccatcacccccatgctcaacccctttgtctacagcctgaggaaccaggaggtgagggctgccctgagcaggggcctggaggaaagggaagatgctggggtgttgaggggtctgtcctag
MGWTNHSVVTEFTLAGFGDRPELQEVLLVVFLTMYLINLVGNVGMILLIHCEPRLHAPMYFFLSHLSLLDISFSSSIIPKFLLSLLTGSRTISYRGCLTQLYFYVMFATAESFLLASMAYDRYVAICNPLRYTVVMSQGLCLRLVVSCYAAGALNSAVQTVAMLRLSFCASHRLDHFYCEGALLFALSCSDTSINDVLMLVFASCTVGTTSTATLLSYGCILATVLQTRSPRARHKAISTCTSHLSVTLLFYGALAFMYMRPGAKRSVKLDKVASIFYTAITPMLNPFVYSLRNQEVRAALSRGLEEREDAGVLRGLS
Other categories referring to ORL9409
Revisions: 1
Last Time: 3/21/2008 12:43:03 PM
Reviewer: CC student
Owner: CC student