SenseLab
Chemosensory Receptors
  Data
ORL9411
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC429670), mRNA
atggaacagattccagtaatctccctgaaggtcacagatcagccagaccttgttttcgatggtcacatgctgcacaggacgcttcatgctctggaaacatctgctctcttcccatcagcaataggccgactccatgcccaggaaccacagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacatgtggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcaggatgtgctgcacaggtctttttcatcttctttctattttcagcagagtattccattctcaccatcatggcctacgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcactgggcttctgcatgctgtgctgcacactgccaatacattttctcaagcactctgccgaggtaaagctgtgaaccagttcttctgtgaaatcccccacatcctcaagctctcctgctcagaatcagactacctcagggaaactgcatttattgtggttactgttcttgccatatatgggtgttttgctttcattcttttctcctatgtgcagatcttcagggctgtgctgaggatgccatctgagcagggacggcacaaagccttctccatgtgcctcccccacctggccgtggtctctctctttgtcagcacggactttctggcctacctgaaaccccattccctggtctccccatccctggacctggtggtgtcatttttgtactcggtggtgcctccaacactgaaccccctcatctacagcatgaggaaccaggagctcaaggatgcagtgaggaaaattatgtcatggacacatttcagcagggataaacttctcatctgtctttacaaatga
MEQIPVISLKVTDQPDLVFDGHMLHRTLHALETSALFPSAIGRLHAQEPQMPNSSSISEFLLLALADMWQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCAAQVFFIFFLFSAEYSILTIMAYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGLLHAVLHTANTFSQALCRGKAVNQFFCEIPHILKLSCSESDYLRETAFIVVTVLAIYGCFAFILFSYVQIFRAVLRMPSEQGRHKAFSMCLPHLAVVSLFVSTDFLAYLKPHSLVSPSLDLVVSFLYSVVPPTLNPLIYSMRNQELKDAVRKIMSWTHFSRDKLLICLYK
Other categories referring to ORL9411
Revisions: 1
Last Time: 3/21/2008 2:33:11 PM
Reviewer: CC student
Owner: CC student