SenseLab
Chemosensory Receptors
  Data
ORL9414
PREDICTED: Gallus gallus similar to olfactory receptor Olfr305 (LOC429521), partial mRNA
gttcttgagcacacaggtcctggtgcccagaagtaccagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcaggatgtgctgcacaggtcttctttttactattcttctttggagcagagtattcccttctcaccatcatgtcctatgatcgctacgttgccatctgcaagcccctgcactatgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcactgggcttctctattccctgctgcacactgccaatacattttctatagctttctgccttagtaatgctgttgatcaattcttctgtgaaatggcccagatcctcaagctttcttgctcagaatccgactacctcagggcaactaggattatttactttagcctttgtttaatctttggatgttttgtcttcattgttttgtcttatgtgcagatcttcagggccgtgctgaggatgccctctgagcagggacagcacaaaaccttctccacgtgcctccctcacctggccgtggtttccttgtttgtcagcactgtgatgttttcctacctgaaacccccctccatctcatctcgatccctggacctgctggtgtcatctgtgtattccttgttgcctccaacactgaatcccctcatctacagcatgaggaaccaggagcttaagggcgccatgggaagggttgcctcccacaagatcaggttgtccagggctggccttgagcacctccagattgccctcattctctattccagtgccttcccaccctctgaggaaagactttcttcctact
VLEHTGPGAQKYQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCAAQVFFLLFFFGAEYSLLTIMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGLLYSLLHTANTFSIAFCLSNAVDQFFCEMAQILKLSCSESDYLRATRIIYFSLCLIFGCFVFIVLSYVQIFRAVLRMPSEQGQHKTFSTCLPHLAVVSLFVSTVMFSYLKPPSISSRSLDLLVSSVYSLLPPTLNPLIYSMRNQELKGAMGRVASHKIRLSRAGLEHLQIALILYSSAFPPSEERLSSY
Other categories referring to ORL9414
Revisions: 1
Last Time: 3/21/2008 2:43:47 PM
Reviewer: CC student
Owner: CC student