SenseLab
Chemosensory Receptors
  Data
ORL9418
PREDICTED: Gallus gallus similar to olfactory receptor, family 5, subfamily U member 1 (LOC429356), mRNA
atgaaccccatcatctacagcatgaggaaccaggagatcaagcaagctctcaggacactgtttggagatacattgcttcggcaccattgtgtcagccctcaggtcctgcgttacgtagcagaccatggagaaacacttttcctgaggtgtgcctggaattgtctcaaaggcttggaagagcattgccatgtcaacagactgaaggctggagacttgggggaggagagtcctgtgaaaaatgagatgtccttgctccgtccaaaacattctgattgtgctgttcttgtgccaagaggtcctggagcccggaagtaccagatgcccaacagcagctccatcagcgagttcctcctcctggcattggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccaggcacatctcctacgcaggatgtgctgctcagatctttttctttctcttcttcctcgcagcagaatattgcattctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcttggggcactgggttccttaattccctgctacacaccaccaatacattttcactgcctctctgccgaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctcctgctcaaaatcctatctcagggaagttgggcttactgtgatcaatgcccttttgttctttgggtgttttgctttcattcttttctcctatgtgcagatcttaagggctgtgctgcggataccctctgagcaggggcggctcaaagccttctccacatgcctccctcacctggctgtggtctccctctttgtcagcactgccacatttgcctatctgaagtctccatcactttcctccccatccctggacctggtggtggcagtgttgtacacggtggtacctccagtcatgaaccccatcatctacagcatgaggaaccaggagatcaagcaagctctcagccgctccgtctctgctgcctttcagttgtgctgctgcttccctggagccacggccatggacagcagcaggacggggggtctgcaggtggtactgatgctatttaagctctttgtcactgacttggacagcgctgttgagtgcaccttcagcaagtttgtgggtgacaccaattcctgtgatgtggtcaacacagtaaagataagggatgccacccagagggaccatgacaagatacagaggtgggtctgtgagaacctcatcaagatcaacaaggccatgtgcaaggatgttcacatggatacatgggtcagagcaatgccatgcacaagtgcaagctga
MNPIIYSMRNQEIKQALRTLFGDTLLRHHCVSPQVLRYVADHGETLFLRCAWNCLKGLEEHCHVNRLKAGDLGEESPVKNEMSLLRPKHSDCAVLVPRGPGARKYQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRHISYAGCAAQIFFFLFFLAAEYCILTIMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGFLNSLLHTTNTFSLPLCRGNAVDQFFCEIPQILKLSCSKSYLREVGLTVINALLFFGCFAFILFSYVQILRAVLRIPSEQGRLKAFSTCLPHLAVVSLFVSTATFAYLKSPSLSSPSLDLVVAVLYTVVPPVMNPIIYSMRNQEIKQALSRSVSAAFQLCCCFPGATAMDSSRTGGLQVVLMLFKLFVTDLDSAVECTFSKFVGDTNSCDVVNTVKIRDATQRDHDKIQRWVCENLIKINKAMCKDVHMDTWVRAMPCTSAS
Other categories referring to ORL9418
Revisions: 1
Last Time: 3/21/2008 2:51:37 PM
Reviewer: CC student
Owner: CC student