SenseLab
Chemosensory Receptors
  Data
ORL9421
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC429288), mRNA
atgtccactggattccagaagcacggttgttcgtatcaaaagaagtttgaccatgagagaagaccagaggatgttctgagcaagtttgctgatgataccaaattgggaggtgctgttgcctccactgaaggtggagaggacttgcagagagatgtggacaagttagagaactgggcatgcagcaaccacatgaagtataacaagaacaagggtctgattccacacctgggtccgggtgcccagaagtaccagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctgcggcaccagggccatctcctacacgggatgtgctgcacaggtcttctttttactattcttatttggtgcagagtattccattctcaccatcatgtcctatgaccgctacgttgccatctgtatgcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcacgggggttctctattccctgatgcacactgccaatacattttccctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctcctgctcagaatactatctcagggaagttgggttactcctttttagtgtctgtttagcctttgggtgttttgtcttcattgttgtgtcctacatgcagatcttcagggctgtgctgagtataccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggccgtggtctgcctgtttctcagcacgggcttttttgcctacttgaagcctccctccatctcctccccatccctggacctggtggtggcacttctgtactctatggttcctccaacactgaaccctattatctacagcatgaggaacaaggagatcaagcatgccctcagcaaattgttgcaatatgcagtattcctgcttcaataa
MSTGFQKHGCSYQKKFDHERRPEDVLSKFADDTKLGGAVASTEGGEDLQRDVDKLENWACSNHMKYNKNKGLIPHLGPGAQKYQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALCGTRAISYTGCAAQVFFLLFLFGAEYSILTIMSYDRYVAICMPLHYGTLLGSRACATMAAAAWGTGVLYSLMHTANTFSLPLCQGNAVDQFFCEIPQILKLSCSEYYLREVGLLLFSVCLAFGCFVFIVVSYMQIFRAVLSIPSEQGRHKAFSTCLPHLAVVCLFLSTGFFAYLKPPSISSPSLDLVVALLYSMVPPTLNPIIYSMRNKEIKHALSKLLQYAVFLLQ
Other categories referring to ORL9421
Revisions: 1
Last Time: 3/21/2008 2:57:04 PM
Reviewer: CC student
Owner: CC student