SenseLab
Chemosensory Receptors
  Data
ORL9424
PREDICTED: Gallus gallus similar to seven transmembrane helix receptor (LOC429244), mRNA
atggagcaggttccaaaaatctccctgaagatcacagttcaaccagatagcggactccatgcccaggaactgcagatgcccaacagcagctccatcagcgagttcctcctcctggcgttggcagacacgcggcagctgcagctcctgcacttctggctcttgctgggcatctacctggctgccctcctgggcaacggcctcatcagcacagccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccagggccatctcctacgcaggatgtgctgcacaggtcttctttttactattcctctttggtgcagagtattcctttctcatagtcatgtcctatgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcactgggcttctctgttccctgctgcacactgccaatacattttcactgcctctctgccaaggcaatgttgtgaaccagttcttctgtgaaatcccccagatcctcaagctcacctgctcaaaatcttatctcagcgaatttggacttattatgcttagtgcccttatattctttgggtgttttgctttcattcttttctcctatgtgcagatcttcagggccgtgctgaggatgccctctgagcagggacggcacaaagccttctccacgtgcctccctcacctggccgtgctctccctctttctcagcactgtcatgtttgcatacctgaagcccttctccatttcctcccaatccctggatctgacagtggcacttctttactcagtgattcctccaacactgaaccctattatctacagtatgaggaacaaggagatcaagcatgccctcagcaaagtgctgcggaggtacagccacagacagcagaacaatgtatatatttgcaactccaggacctataccgtagcctgcgaccaccgcctgcacacccccatgtacttcttcctcctcaacctcgccctcctcgacctgggctgcatctccaccactctccccaaagccatggccaatgccctctggcacaccagggccatctcctacgcaggatgtgctgctcaggtctttttcttcttctttttgtttggagcagagtattgcattctcaccatcatgtcctatgaccgctacgttgccatctgcaagcccctgcactacgggaccctgctgggcagcagagcttgtgccaccatggcagcagctgcctggggcactggggtccttaattccctgctgcacactgccagtacattttccctgcctctgtgccaaggcaatgctgtggatcagttcttctgtgaaatcccccagatcctcaagctctcctgctcacagttctacctcaaggaaatttcacttcttgtatttagtatatctttagcatctgggtgttttgttttcattcttttctcctatctgcaggttttcagggctgtgctgaggatgccctctgagcacggacggcacaaagccttctccacgtgcctccctcacctggctgtgctctccctatttttcagtactgcctttttggcatacctgaaacccccctccctcttctccccatctctgaacctgctggtgtcatttctctactcggtggttcctccaacactgaatcccctcatctacagcatgaggaaccaggaactcagggatgcagtgaggaaaatgatgccctggtcacgtttcagcagggataaacttctcatctgtctctgcaaatga
MEQVPKISLKITVQPDSGLHAQELQMPNSSSISEFLLLALADTRQLQLLHFWLLLGIYLAALLGNGLISTAVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRAISYAGCAAQVFFLLFLFGAEYSFLIVMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGLLCSLLHTANTFSLPLCQGNVVNQFFCEIPQILKLTCSKSYLSEFGLIMLSALIFFGCFAFILFSYVQIFRAVLRMPSEQGRHKAFSTCLPHLAVLSLFLSTVMFAYLKPFSISSQSLDLTVALLYSVIPPTLNPIIYSMRNKEIKHALSKVLRRYSHRQQNNVYICNSRTYTVACDHRLHTPMYFFLLNLALLDLGCISTTLPKAMANALWHTRAISYAGCAAQVFFFFFLFGAEYCILTIMSYDRYVAICKPLHYGTLLGSRACATMAAAAWGTGVLNSLLHTASTFSLPLCQGNAVDQFFCEIPQILKLSCSQFYLKEISLLVFSISLASGCFVFILFSYLQVFRAVLRMPSEHGRHKAFSTCLPHLAVLSLFFSTAFLAYLKPPSLFSPSLNLLVSFLYSVVPPTLNPLIYSMRNQELRDAVRKMMPWSRFSRDKLLICLCK
Other categories referring to ORL9424
Revisions: 1
Last Time: 3/21/2008 3:01:49 PM
Reviewer: CC student
Owner: CC student