SenseLab
Chemosensory Receptors
  Data
ORL9442
PREDICTED: Gallus gallus similar to olfactory receptor Olr62 (LOC419080), mRNA
1
atggagcatgactcacataccacgtgggaattcaatggctccttctatcagccttcagctttcctcatgatgggcatcccaggcctggaagcctttcatcactggatctccatccctttttgtgtactctaccttattgctctcttgggaaattgcatgatcctattcgtcataaagaagacccaaagtcttcatgaacccatgtactactttctctccatgctagcagtcactgacctggggctggttttatgtacactgcctactacactgggtattttttggtttaataaccgaaggattggttttgatgcttgtctcactcagatgtatttcatccacatactgtccttcattgaatcctcggtgctcctggcaatggcgtttgatcgcttcattgctatctcccatccacttagatacccatccatactgaccaagacaaccgtcataaagataggtctgacaatcatattgagaggtacggtctcccttcttccaatacccttcttgctcaagaggttaacctactgtgggaagactgagctctctcattctttttgcttccatcctgatatcatgaacctagcgtgtgcagatataaaagtcaatatcttctatggtctgattgctttgttttcaacagtagggatggattttatctgcattgtgctgtcctacatcctaatcattaaaactgttatcagccttgcaactaaggaggagtgtctcaaggctttgaatacatgcgtctcccacatctgtgctgtcctaatattcttcatcccaatgattggactgtccatgattcatcgtttcggaaagaactttcctcctttggttaacaccttggtggcctacacctaccttataattccccctgctctcaaccccattatctacagcataaaatccagccatatccgcgaggctttgttcaggacactgaggaggaagtgtgaatttgagtggtaggttcttccaccaactgtgccagaaaatgctggtggactttttttgtggtcagaactagtagactggtttcttagtgctgcacccatgggtgtcactgccaggcaaaggaactgcgcatccactcagatgctgtccctcaacccagagctgtgatctttcatgtttcatcctagcatgatgcttggtcctttccaacagcctgcacacaccccaggcgtggaagtcacacttatgaggaaacaattacaggaaaacaagctcctcctcttgagttacacaatggagtggagcaaggaaactctacaatatactttatggcatctagcagtcagataatatgtaagcttcacctgcggtcccttgcatgggatcattgttccctcactgcataactaaccaagaccacaaactctgtaggacaggacagaggccaaaagtctgaagtcactctgaatatcaaagtgagtaattttgttcaactggaaacaccccacaaaatggagatcatttccagaggttgagcacagagcatttttggaagatcacatcattttaagtgaacccacaacacttggttcaccta
MEHDSHTTWEFNGSFYQPSAFLMMGIPGLEAFHHWISIPFCVLYLIALLGNCMILFVIKKTQSLHEPMYYFLSMLAVTDLGLVLCTLPTTLGIFWFNNRRIGFDACLTQMYFIHILSFIESSVLLAMAFDRFIAISHPLRYPSILTKTTVIKIGLTIILRGTVSLLPIPFLLKRLTYCGKTELSHSFCFHPDIMNLACADIKVNIFYGLIALFSTVGMDFICIVLSYILIIKTVISLATKEECLKALNTCVSHICAVLIFFIPMIGLSMIHRFGKNFPPLVNTLVAYTYLIIPPALNPIIYSIKSSHIREALFRTLRRKCEFEW
Other categories referring to ORL9442
Revisions: 1
Last Time: 3/21/2008 3:45:50 PM
Reviewer: CC student
Owner: CC student