SenseLab
Chemosensory Receptors
  Data
ORL9507
Ictalurus punctatus olfactory receptor 1 mRNA, complete cds
atgacttctgtgctgaatgcactgtctgcaaatgcaacatttattcgcccttccactttttatataaatgggttttacaatattccacacacgaagtactactatgcctttctctgcattgcctatgctgtgacagttttagggaattcttttataatgtgcaccatctatctagcacgtagcctccatactgcaaagtacattactgtgtttaacttggctctttctgatttgggtggcagctctgctcttattccaaaacttattgatacttttctgtttgagaatcaggtcatatcatatgaagcctgtctggcaaacatgttttttgtcttattctttatgaccgtgcagtctcttactctgcttgttatggcctatgacagagtagttgctatatgttttcctttaaggtataatgtcattgtcaccaaagaagcaatgactttaatcattgtcattacctggattttctctataagtattattgcactccttgtagctctgattaccagactgtccttctgtagatctgtaattatcaacagctatttctgtgatcatgggcctatcttgattttagcttgtaatgataaatttataaatcgtgtcatggccataggctgttttgttgtgctggattgtgttccatttctgttaataattgtctcttatatttgtattggcattgccttgatgaatatctcgcatggtttggagcggagaaaagctatgaaaacctgtacttcccaccttattttagtggctttattttatctcccgtttataggcaccaatataacatctcttacatcatctataaatgcaaatgataggatactaaattctacactgacacagattattccccccatgttaaaccccattatatatacgttaaagacagaggaggtcatgcaggcggttaaagtgctctacaaacgggccaaagcggtagtgatatgtgacattcccaatggacaggtatttcaaccatgggtaggagttgacagtaaaaaaaaaactttttgttga
MTSVLNALSANATFIRPSTFYINGFYNIPHTKYYYAFLCIAYAVTVLGNSFIMCTIYLARSLHTAKYITVFNLALSDLGGSSALIPKLIDTFLFENQVISYEACLANMFFVLFFMTVQSLTLLVMAYDRVVAICFPLRYNVIVTKEAMTLIIVITWIFSISIIALLVALITRLSFCRSVIINSYFCDHGPILILACNDKFINRVMAIGCFVVLDCVPFLLIIVSYICIGIALMNISHGLERRKAMKTCTSHLILVALFYLPFIGTNITSLTSSINANDRILNSTLTQIIPPMLNPIIYTLKTEEVMQAVKVLYKRAKAVVICDIPNGQVFQPWVGVDSKKKTFC
Other categories referring to ORL9507
Revisions: 1
Last Time: 3/24/2008 3:08:05 PM
Reviewer: CC student
Owner: CC student