SenseLab
Chemosensory Receptors
  Data
ORL9510
Ictalurus punctatus olfactory receptor 202 mRNA, complete cds
atgccggaaggaaacattaccaatgttaagaattttgtcattctaggttttcctggacttccccctaattactatggtcttgtctcagtggttatgttttttgtttatgtatgcaccttaataggaaattgtactttttttacattatttctaagagaaaaaagtcttcaaaaacctatgtattatatcatgttaaatcttgctgcatcagatgtgctgtttagcaccacaactttacccaagattattgcaagatattggtttggtgatggctccatctcttttgtgggctgctttattcagatgcaatttgtgcattattttgctacagttaatgcattggtgctagcagtcatggcctttgatagatatgtggcagtctgtaatccactcagatatgttaatattgtcaaagaatccactatcttgggtttatgcgttgtatcctggctgttagctgagcctactgtcttgactacggtaatcagggcaacctctcttccttattgtgcttccaacacagtcatccaatgctactgtgaccatgtgtctgtcacgaagcttgcatgcattgacagaacaccctatgcatttccagctctagtttcagctctggttatgctgctcacaccactagcatttattctgttctcttatggttctattattgtgacggtgtttcgaacttcatccacacgtggacggctaaaaactctctccacatgcagttctcagcttataattatcaccctcttttttttaccacggtgtttaaattatttatcctccagtttaggtatacacatcaacgctgatatacaaatacttgttattatgttgtacagcctgcttccccctatgatcaatccagtcatctactgtttgaggacaaaagaagctaaagaatgcttaaagaggagcttaaacaggtcatcgtttgttcagtttttgaagataaatgtccaggtttctactctatctaattga
MPEGNITNVKNFVILGFPGLPPNYYGLVSVVMFFVYVCTLIGNCTFFTLFLREKSLQKPMYYIMLNLAASDVLFSTTTLPKIIARYWFGDGSISFVGCFIQMQFVHYFATVNALVLAVMAFDRYVAVCNPLRYVNIVKESTILGLCVVSWLLAEPTVLTTVIRATSLPYCASNTVIQCYCDHVSVTKLACIDRTPYAFPALVSALVMLLTPLAFILFSYGSIIVTVFRTSSTRGRLKTLSTCSSQLIIITLFFLPRCLNYLSSSLGIHINADIQILVIMLYSLLPPMINPVIYCLRTKEAKECLKRSLNRSSFVQFLKINVQVSTLSN
Other categories referring to ORL9510
Revisions: 1
Last Time: 3/24/2008 3:14:14 PM
Reviewer: CC student
Owner: CC student