SenseLab
Chemosensory Receptors
  Data
ORL9511
Ictalurus punctatus olfactory receptor 47 mRNA, complete cds
atgaatagcaccaatagcacagattcatttgataaaggattttatctaattgcttacaattctttgggcaataagaactacctgatattggcattaggaattatctacctgatcacactgctatgtaattttactcttctggctataatcctgatgaactccagtttacagaaccccaagtttcttgcagtttttaacctcgctgtagttgacatttctataaacagtgttattattccacaaatggttcctgtgtttgtatttaacctcaatcacatcagttttgaatcatgcttctcccagatgtttttcatgcacttttttggtgacatggagtccttttcactggctctattggcttatgatcgcctgattgctatctgctttcctttacgctaccctactatcaatactaatatgcggatggtgctcatcatagccagcctgtggtttctggtttttttgattgagctttaccctgtagctctggccagtggtctctcctactgtagatcaagggtggttcccagctgttgttgtgagcatggcccagtttataacctagcctgtggagatatttcttataacaagagactggcacttgctaaaacgttagttgtcctgcttggtcctttgactttcatcatttgctcttatgtcatagtggtggtggcagtcttgcgaattgcgtctccgacacaatgctggaaggccttcaacacctgtcttactcacatgatcttggtcctcatttattatctgccaatcattttggcttacatactagggaacttgaaattactgcaatcagctgatctttacacagcaggtctaacagtctgtgtcacattgccagcaatgttaaaccctatcatatatagcttaaagactgaggaactgcaagacaagttgctgaaatttattaagccgcaaaaagtgtcaaatacagtctaa
MNSTNSTDSFDKGFYLIAYNSLGNKNYLILALGIIYLITLLCNFTLLAIILMNSSLQNPKFLAVFNLAVVDISINSVIIPQMVPVFVFNLNHISFESCFSQMFFMHFFGDMESFSLALLAYDRLIAICFPLRYPTINTNMRMVLIIASLWFLVFLIELYPVALASGLSYCRSRVVPSCCCEHGPVYNLACGDISYNKRLALAKTLVVLLGPLTFIICSYVIVVVAVLRIASPTQCWKAFNTCLTHMILVLIYYLPIILAYILGNLKLLQSADLYTAGLTVCVTLPAMLNPIIYSLKTEELQDKLLKFIKPQKVSNTV
Other categories referring to ORL9511
Revisions: 1
Last Time: 3/24/2008 3:16:00 PM
Reviewer: CC student
Owner: CC student