SenseLab
Chemosensory Receptors
  Data
ORL9512
Ictalurus punctatus olfactory receptor 8 mRNA, complete cds
atgttggctcctgtacaaaatatttcatttacaacttttacacttactggttttcatgatttgggagaatgggggcccattctatccattccttatcttcttatgtttttattgtcttcgacttcaaaccttaccctcatatatttaattatatctcagagggctcttcattctcctatgtgtatactaattggtcttatggcagttgtggacctgtctatgccaatattttgtgtgccaaatatgctgctaagtttcttatttaactggaaaggaatttcacttgtggggtgtttggtgcaaatgttttgcatacattgtgctggtacatttcaatctactatactgctttggatggctctggatcgtttttttgctatatgtagacctctttattaccaaaaatacatgggaatgcccaattttctaaagttcattatttttccagttatcagaaatctgttttttattaccacaattgtttcctgggctggaaaattaactttttgtgaaacaaatgaaatagatcattgtgtttgtgaacacatggcattggttcagctggcatgtggagatatttccattaacaatgcattggggcttttgactgtttttcttacaataactgctgattttattttcattacaatatcatatatagtaatacttgtttctattctgagatctggtaaggcgtgcttaaaggctgttaacacctgcattactcatataattgtcatgacagtgagtctgacctttgctttaattgcctttttgtcatacagaataagaaacttctctccgtccagccgtgtcttcctgagtacaatgtacttgtttattccaagctgttttaatccaattatttatggtgtaagaaccaaagaaataagagaacagtttctgaaactcatgaaatatgttaaggtctttccaaagtaa
MLAPVQNISFTTFTLTGFHDLGEWGPILSIPYLLMFLLSSTSNLTLIYLIISQRALHSPMCILIGLMAVVDLSMPIFCVPNMLLSFLFNWKGISLVGCLVQMFCIHCAGTFQSTILLWMALDRFFAICRPLYYQKYMGMPNFLKFIIFPVIRNLFFITTIVSWAGKLTFCETNEIDHCVCEHMALVQLACGDISINNALGLLTVFLTITADFIFITISYIVILVSILRSGKACLKAVNTCITHIIVMTVSLTFALIAFLSYRIRNFSPSSRVFLSTMYLFIPSCFNPIIYGVRTKEIREQFLKLMKYVKVFPK
Other categories referring to ORL9512
Revisions: 1
Last Time: 3/24/2008 3:17:49 PM
Reviewer: CC student
Owner: CC student