SenseLab
Chemosensory Receptors
  Data
ORL9513
Ictalurus punctatus olfactory receptor 32B mRNA, partial cds
atgaatgccttgaactccagtttattacaaaatgtatcatttgtgcgtccagagtactttttcatcagtggattttctggaattcctttcagccaatactattttgtttttttaatttttatctatattatctcactgtgtggtaactcaatagtccttttcatgatattagttgaccgaactctgcatattccaaaatacatggggatttttaatttagcactgtcagactttggtgaaacaaatgcactgattcctagccttgtgaagactttgttttttgattcacagtacatatcctacgatgcttgtttggctaacatgttttttacttttttcttttttggtggacaggcattaactcttgttgccctggcatatgatcgttttattgccatttgcttacctctgagataccatgctattgtaaataactccttcatgtttgcaactttaacagcaatatgggtatttaatcttgttatgattggcacattggtagttttgattacacgactttcattctgtaaaaccaatgagataaagagctttttttgtgaccatgggccagtttatacaattgcttgtaatgacaacagcattaattccttcatggctaagctgtgtactgcagtatacctctatgcaccattgactgctatagtcttatcatacataggcattctgctggccttaactaagattacaacatgggagagtcgtcttaaagcactcaaaacttgcatctctcacctgttggtagtaggagtatttttcctacctatagtgggtacgtatcttgctgcattaactttctctctccatcctaatgctaggataattaatacttcactatcaagaactattccacccatgttaaatcccatcatttatgtcttgaacacaaaggatttcagagtctttatagtgaaaatgcttaaaaagaaaaccaccaaaatttcccaagtgcatgctttagcaaag
MNALNSSLLQNVSFVRPEYFFISGFSGIPFSQYYFVFLIFIYIISLCGNSIVLFMILVDRTLHIPKYMGIFNLALSDFGETNALIPSLVKTLFFDSQYISYDACLANMFFTFFFFGGQALTLVALAYDRFIAICLPLRYHAIVNNSFMFATLTAIWVFNLVMIGTLVVLITRLSFCKTNEIKSFFCDHGPVYTIACNDNSINSFMAKLCTAVYLYAPLTAIVLSYIGILLALTKITTWESRLKALKTCISHLLVVGVFFLPIVGTYLAALTFSLHPNARIINTSLSRTIPPMLNPIIYVLNTKDFRVFIVKMLKKKTTKISQVHALAK
Other categories referring to ORL9513
Revisions: 1
Last Time: 3/24/2008 3:19:33 PM
Reviewer: CC student
Owner: CC student