SenseLab
Chemosensory Receptors
  Data
ORL9514
Ictalurus punctatus olfactory receptor 32C mRNA, partial cds
atgagtgccttgaactccagtttattacaaaatgtatcatttgtgcgtccagagtactttttcatcagtggattttctggaattcctttcagccaatactattttgtttttttaatttttatctatattatctcactgtgtggtaactcaatagtccttttcatgatattagttgaccgaactctgcatattccaaaatacatggggatttttaatttagcactgtccgacattggtgaaacaaatgcattgattcctagccttgtgaagactttgttttttgattcacagtacatatcctatgatgcttgtttgactaacatgttttttacttttttcttttctggtggacaggcattaactcttgttgccctggcatatgatcgttttattgccatttgtttacctctgagataccatgctattgtaaataactccttcatgtttgcaactttaacagcaatatgggtatttaatcttgttatatttggcacaactgtagtttttattacacgactttcattctgtaaaaccaatgagataaagagctttttttgtgaccatgggccagtttatacaattgcttgtaatgacaacagcataaattccttcatggctaagctgtgtactgcagtatacctctatgcaccattgactgctatagtcttatcatacataggcattctgctggccttaactaagattacaacatgggagagtcgtcttaaagcactcaaaacttgcatctctcacctgttggtagtaggagtgtttttcctacctatagtgggtacgtaccttgctgcattaactttctctctccatcctaatgctaggataattaatacttcattatcaagaactattccacccatgttaaatcccattatttatgtcttgaacacaaaggatttcagagtctttatagtgaaaatgcttaaaaagaaaaccaccaaaatttcccaagtgcatgctttagcaaag
MSALNSSLLQNVSFVRPEYFFISGFSGIPFSQYYFVFLIFIYIISLCGNSIVLFMILVDRTLHIPKYMGIFNLALSDIGETNALIPSLVKTLFFDSQYISYDACLTNMFFTFFFSGGQALTLVALAYDRFIAICLPLRYHAIVNNSFMFATLTAIWVFNLVIFGTTVVFITRLSFCKTNEIKSFFCDHGPVYTIACNDNSINSFMAKLCTAVYLYAPLTAIVLSYIGILLALTKITTWESRLKALKTCISHLLVVGVFFLPIVGTYLAALTFSLHPNARIINTSLSRTIPPMLNPIIYVLNTKDFRVFIVKMLKKKTTKISQVHALAK
Other categories referring to ORL9514
Revisions: 1
Last Time: 3/24/2008 3:21:35 PM
Reviewer: CC student
Owner: CC student