SenseLab
Chemosensory Receptors
  Data
ORL9515
Ictalurus punctatus olfactory receptor 32D mRNA, partial cds
atgagtgccttgaactccagtttattacaaaatgtatcatttgtgcgtccagagtactttttcatcagtggattttctggaattcctttcagccaatactattttgtttttttaatttttatctatattatctcactgtgtggtaactcaatagtccttttcatgatattagttgaccgaactctgcatattccaaaatacatggggatttttaatttagcactgtcagactttggtgaaacaaatgcgttgattcctagccttgtgaagactttgttttttgattcacagtacatatcctatgatgcttgtttggctaacatgttttttacttttttctttgctggtggacaggcattaactcttgttgccctggcatatgatcgttttattgccatttgcttacctctgagataccatgctattgtaaataactccttcatgtttgtaactttaatagcaatatgggtatttaatgttgttataattggtacgactgtagtttttattacacgactttcattctgtaaaaccaatgagataaagagctttttttgtgaccatgggccagtttatacaattgcttgtaatgacaacagcattaattccttcatggcatacttctgtactgcagtatacctttatgcaccattgactgctatagtcttatcatacataggcattctgctggccttaactaagattacaacatgggagagtcgtcttaaagcactcaaaacatgcatctctcacctgttggtagtaggagtgtttttcctacctatagtgggtacgtaccttgctgcagtaactttctctctccatcctaatgctaggataattaatacttcattatcaagaactattccacccatgttaaatcccattatttatgtcttgaacacaaaggatttcagagtctttatagtgaaaatgcttaaaaagaaaaccaccataatttcccaagtgcatgctttagcaaag
MSALNSSLLQNVSFVRPEYFFISGFSGIPFSQYYFVFLIFIYIISLCGNSIVLFMILVDRTLHIPKYMGIFNLALSDFGETNALIPSLVKTLFFDSQYISYDACLANMFFTFFFAGGQALTLVALAYDRFIAICLPLRYHAIVNNSFMFVTLIAIWVFNVVIIGTTVVFITRLSFCKTNEIKSFFCDHGPVYTIACNDNSINSFMAYFCTAVYLYAPLTAIVLSYIGILLALTKITTWESRLKALKTCISHLLVVGVFFLPIVGTYLAAVTFSLHPNARIINTSLSRTIPPMLNPIIYVLNTKDFRVFIVKMLKKKTTIISQVHALAK
Other categories referring to ORL9515
Revisions: 1
Last Time: 3/24/2008 3:23:38 PM
Reviewer: CC student
Owner: CC student